Como É Que A Informação Contida No Dna Se Expressa?

O dogma central da Biologia Molecular foi proposto por Francis Crick, biólogo molecular, biofísico e neurocientista britânico, em 1958.

A partir de então estabelece-se o paradigma da Biologia Molecular, no qual a informação é conservada através da replicação do DNA e é traduzida através dos processos de transcrição. Tais processos, por sua vez, convertem a informação do DNA em uma forma mais acessível, representada por uma fita de RNA complementar e de tradução, que converte a informação contida no RNA em proteínas

Francis Crick (Fonte: Unknown – [1], CC BY 4.0 / Wikimedia

Como É Que A Informação Contida No Dna Se Expressa?

Atenção! Aqui existe uma videoaula, acesso pelo conteúdo online

O termo expressão gênica diz respeito ao processo em que a informação codificada por um determinado gene é traduzida e, portanto, decifrada, em uma proteína.

Em teoria, o controle, em qualquer uma das fases desse processo, pode ocasionar uma expressão gênica diferencial.

Em organismos multicelulares, a expressão gênica controlada regula um programa genético imprescindível para o desenvolvimento embrionário e sua diferenciação. Nesse sentido, uma célula é capaz de regular a expressão gênica através de diversos mecanismos, dentre os quais, como um transcrito primário de RNA sofre splicing ou é processado.

(Fonte: Nathan Devery / Shutterstock)

Como É Que A Informação Contida No Dna Se Expressa?

A ausência e/ou desequilíbrio de mecanismos da regulação gênica pode, inclusive, determinar o estabelecimento de doenças. É esta temática que será abordada na aula de hoje.

Fluxo de informações do código genético

O dogma central da biologia molecular descreve como ocorre o fluxo de informações do código genético. Segundo esse dogma, o fluxo da informação genética segue o seguinte sentido:

DNA → RNA → PROTEÍNAS

(Fonte: Antonov Maxim / Shutterstock).

Como É Que A Informação Contida No Dna Se Expressa?

Observa-se, portanto, que esse dogma demonstra todos os processos pelos quais os ácidos nucleicos podem passar. Dessa forma, temos o DNA, onde está contida a informação genética, que pode ser transcrito em moléculas de RNA.

É nessa molécula de RNA que é encontrado o código usado para organizar a sequência de aminoácidos e formar as proteínas no processo de tradução, o qual consiste na união de aminoácidos, obedecendo à ordem de códons presentes em uma molécula de RNA mensageiro.

Observamos que o DNA de um organismo codifica todas as moléculas de RNA e de proteínas necessárias para a construção e perfeito funcionamento de suas células

(Fonte: Natali_ Mis / Shutterstock)

Como É Que A Informação Contida No Dna Se Expressa?

Embora possamos ter uma descrição completa da sequência de DNA de um organismo, isso não nos possibilita reconstruir esse organismo.

Vocês podem se questionar: Por que não? Porque o problema não é conhecer como os elementos funcionam em uma sequência de DNA, mas em quais condições cada produto gênico é produzido. Uma vez produzido, o que ele faz?

Os diferentes tipos celulares em um organismo multicelular diferem drasticamente, tanto em estrutura como em função.

Se compararmos um neurônio com uma célula do fígado, por exemplo, as diferenças são tão extremas que é difícil imaginar que as duas células contenham o mesmo genoma. Por essa razão e porque a diferenciação celular com frequência parecesse irreversível, os biólogos originalmente suspeitaram que genes deveriam ser seletivamente perdidos quando uma célula se diferencia.

Agora sabemos, entretanto, que a diferenciação celular geralmente ocorre sem alterações na sequência de nucleotídeos do genoma da célula.

Os tipos de células em um organismo multicelular tornam-se diferentes uns dos outros porque eles sintetizam diversas moléculas de RNA e proteínas.

(Fonte: cigdem / Shutterstock)

Como É Que A Informação Contida No Dna Se Expressa?

Para explicar isto, existem algumas afirmativas importantes:

Como veremos nesta aula, existem muitos passos após a produção do RNA nos quais a expressão gênica pode ser regulada.

Uma célula pode controlar as proteínas que produz de seis formas.

1

Regulando quando e como um determinado gene é transcrito, o que chamamos de controle transcricional.

2

Controlando como o transcrito de RNA é processado (controle do processamento de RNA).

3

Selecionando quais RNAs mensageiros completos serão exportados do núcleo para o citoplasma e onde ficarão localizados (controle do transporte e da localização de RNA).

4

Selecionando quais RNAs mensageiros no citoplasma serão traduzidos pelos ribossomos (controle traducional).

5

Desestabilizando, de forma seletiva, algumas moléculas de RNA mensageiro no citoplasma (controle da degradação do RNAm).

6

Ativando, inativando, degradando ou compartimentalizando moléculas de proteínas específicas após sua produção (controle da atividade proteica).

Para a maioria dos genes, os controles transcricionais são os mais importantes. Isso porque, de todos os pontos possíveis de controle, somente o controle transcricional garante que a célula não sintetizará intermediários desnecessários.

A transcrição de genes individuais é ativada e desativada nas células por reguladores transcricionais

Atenção! Aqui existe uma videoaula, acesso pelo conteúdo online

Em organismos procariontes, essas proteínas normalmente ligam-se às sequências de DNA específicas próximas do sítio de início da RNA-polimerase e, dependendo da natureza da proteína reguladora e da localização do seu sítio de ligação em relação ao sítio de início, pode tanto ativar como reprimir a transcrição do gene.

A flexibilidade da dupla-hélice do DNA pode permitir que proteínas ligadas em sítios distantes afetem a RNA-polimerase na sequência promotora do gene.

(Fonte: Sergey Nivens / Shutterstock)

Como É Que A Informação Contida No Dna Se Expressa?

Lembrem-se que promotores ou sequências promotoras são sequências de DNA específicas importantes para o início da transcrição. Tais sequências são reconhecidas por algumas proteínas específicas, chamadas de fatores de transcrição, que trazem a RNA-polimerase para realizar a montagem dos RNAs.

Um único gene eucariótico normalmente é controlado por muitos reguladores transcricionais ligados a sequências que podem estar localizadas a dezenas ou até a centenas de milhares de pares de nucleotídeos do promotor que direciona a transcrição do gene.

(Fonte: urfin / Shutterstock)

Como É Que A Informação Contida No Dna Se Expressa?

Os ativadores e os repressores eucarióticos atuam por meio de vários mecanismos — geralmente alterando a estrutura local da cromatina e controlando a associação dos fatores gerais de transcrição e da RNA-polimerase no promotor.

Eles fazem isso atraindo coativadores e correpressores, que são complexos proteicos que desempenham as reações bioquímicas necessárias. O momento e o local no qual cada gene é transcrito, assim como suas taxas de transcrição sob diferentes condições, são determinadas por um conjunto particular de reguladores transcricionais que se ligam à região reguladora do gene.

Controles pós-transcricionais

Conforme dito anteriormente, para a maioria dos genes, os controles transcricionais são os mais importantes. Porém, outros controles podem atuar mais tarde, na via do DNA para a proteína, a fim de modular a quantidade de produto gênico que é produzida — e em alguns casos, para determinar a sequência de aminoácidos do produto proteico.

Esses controles pós-transcricionais, que operam após a RNA-polimerase ter se ligado ao promotor do gene e iniciado a síntese do RNA, são cruciais para a regulação de muitos genes.

Um dos mecanismos do controle pós-transcricional que abordaremos nesta aula é denominado splicing. Mas, para falarmos sobre isto, precisamos compreender o mecanismo de processamento do RNA.

Atenção! Aqui existe uma videoaula, acesso pelo conteúdo online

(Fonte: AuntSpray / Shutterstock)

Como É Que A Informação Contida No Dna Se Expressa?

Importante observar, inclusive, que a transcrição é apenas a primeira de diversos passos necessários para a síntese de uma molécula de RNAm madura. Outras etapas essenciais incluem a modificação covalente de ambas as extremidades do RNA e a remoção de sequências de íntrons que são retiradas do transcrito pelo processo de splicing do RNA.

Lembremos que a sequência codificante de um gene é a série de códons, compostos por três nucleotídeos (trincas), que especifica a sequência linear dos aminoácidos no produto polipeptídico.

Nos genes eucarióticos, a sequência codificante é periodicamente interrompida por segmentos com sequências não codificantes. Muitos genes eucarióticos são, portanto, mosaicos, compostos por blocos com sequências codificantes, os éxons, separadas entre si por blocos com sequências não codificantes, os íntrons.

(Fonte: Gio.tto / Shutterstock)

Como É Que A Informação Contida No Dna Se Expressa?

Vocês devem estar se perguntando, por que em organismos procariotas não ocorre este processamento do RNA mensageiro.

Nos organismos procariotas, a transcrição e a tradução são simultâneas e, deste modo, o RNA não sofre qualquer processamento.

compare_arrows

Já em eucariotas, existe uma compartimentalização, de modo que a transcrição ocorre no núcleo e a tradução no citoplasma.

O RNA recém-obtido pela ação da RNA-polimerase, é um transcrito primário (pré-RNA), que sofrerá processamento para originar o RNA mensageiro final (RNAm maduro).

Veja, agora as etapas do processamento.

Clique nos botões para ver as informações.Objeto com interação.

Leia também:  Como Somar Horas No Excel Quando Passa De 24 Horas?

A primeira etapa do processamento é caracterizada pela adição do CAP 5’. E o que seria o CAP 5’ e por que é adicionado?

Pois bem, na extremidade 5’ do transcrito inicial, um dos três fosfatos é removido e é adicionada a base nitrogenada guanina.

Em seguida, essa base é metilada na posição 7, assim como o segundo e terceiro nucleotídeos, entretanto, para estes dois últimos, a metilação ocorre na posição 2’ do açúcar. A adição do CAP 5’ confere ao RNA uma maior estabilidade, pois protege-o da ação de fosfatases e nucleases.

A segunda etapa do processamento do RNA é adição da cauda poli-A. E o que seria isto? A cauda poli-A é uma estrutura localizada na extremidade 3' da maioria dos RNAm de eucariotas, sendo composta pela ligação de 80 a 250 resíduos de adenina.

Essa cauda tem a função de atuar como acentuadora da tradução, proteger o RNAm da digestão por nucleases presentes no meio e proporcionar uma maior estabilidade à molécula. Especula-se, ainda, que ela também tenha um papel importante no transporte do RNAm para o citoplasma.

A última etapa do processamento é o que chamamos de splicing, onde serão removidos os íntrons e unidos os éxons. Vamos entender como este processo ocorre a seguir.

Primeiro, é importante saber que além dos RNAs conhecidos por nós (RNAm, RNA transportador e RNA ribossômico), existem outros RNAs compostos por menos de 300 nucleotídeos. Tais RNAs são chamados de snRNAs (small nuclear RNAs) e scRNAs (small cytoplasmatic RNAs).

Os RNAs são importantes porque se associam a proteínas formando complexos chamados de snRNPs (pequenas partículas de ribonucleoproteínas nucleares, do inglês small nuclear ribonucleoprotein particles) e scRNPs (pequenas partículas de ribonucleoproteínas citoplasmáticas, do inglês small cytoplasmatic ribonucleoprotein particles).

Para o processo de splicing ocorrer, é necessária a formação de grandes arranjos compostos por snRNPs e precursores de RNAm, denominados spliceossomos.

Serão tais complexos que farão a excisão dos íntrons do RNAm, processo que requer alta precisão das enzimas envolvidas.

A falta ou acréscimo de um único nucleotídeo em um éxon pode promover uma alteração de fase de leitura e levar à produção de uma proteína totalmente diferente da original.

(Fonte: Syda Productions / Shutterstock)

Como É Que A Informação Contida No Dna Se Expressa?

Como o splicing é um mecanismo complexo, altamente regulado, uma mutação em um local de reconhecimento na junção íntron e éxon, ou mesmo em um elemento regulador, pode ocasionar uma falha no processo, gerando um produto anômalo, que pode, diversas vezes, inativar um gene, com sérias consequências.

Considera-se que cerca de 10% das doenças genéticas são causadas por equívocos no processo de splicing.

Entretanto, pesquisas envolvendo ferramentas de Bioinformática e Biologia Molecular podem suscitar estratégias capazes de retificar sequências que abalam padrões de splicing, como também expressar, silenciar ou alterar as concentrações de reguladores, a fim de reparar genes afetados por deleções, a exemplo do que ocorre na distrofia muscular progressiva.

(Fonte: Kjpargeter / Shutterstock)

(Fonte: udaix / Shutterstock)

Segundo o fluxo da informação genética DNA—RNA— proteínas, a sequência de nucleotídeos presentes em um gene será transcrita em uma molécula de RNAm, a qual será traduzida em proteína.

Esta sequência origina a ideia de que, para cada gene, uma proteína é produzida. Entretanto, como veremos, existem alguns pré-RNAs que podem ser processados por mais de uma forma, dando origem a RNAm alternativos. Esse processo denomina-se processamento ou splicing alternativo.

Assim, podemos concluir que a partir de um gene, mais de uma proteína pode ser formada. Estudos apontam que cerca de 60% dos genes presentes no genoma humano podem ser processados de forma alternativa, gerando, portanto, mais de uma proteína por gene.

O processamento alternativo pode acontecer de diversas formas, podendo-se observar a extensão de éxons ou mesmo omissão. Em alguns, os íntrons são mantidos ao invés de serem eliminados, elevando a diversidade de proteínas produzidas.

Como a regulação da expressão gênica pode ter impacto na etiologia de doenças?

Diagnósticos moleculares de distúrbios aparentemente devidos a defeitos genéticos ou genômicos ainda necessitam de maior número de casos investigados, apesar do grande número de estudos projetados para descobrir defeitos nas regiões codificadoras de proteínas do genoma.

Existe um aumento crescente de estudos para pesquisar defeitos em regiões do genoma não codificadoras e alterações na expressão gênica.

Antes de prosseguirmos, é importante esclarecer o que significa o termo terapia gênica.

A terapia gênica consiste, basicamente, na manipulação ou correção da expressão gênica em células-alvo ou, ainda, a transferência de genes para células com finalidade terapêutica.

(Fonte: CI Photos / Shutterstock)

Em 1990, o uso da terapia gênica em seres humanos foi iniciado.

Àquela época, o objetivo foi o tratamento de uma paciente com imunodeficiência letal, causada pela deficiência da enzima adenosina deaminase, cujo papel está envolvido no metabolismo de purinas, existindo, em grande quantidade, em linfócitos e monócitos ativados, sobretudo linfócitos T helper. Nesse caso, a paciente recebeu uma transfusão de linfócitos geneticamente corrigidos e cuja expressão do transgene foi de longa duração.

(Fonte: CI Photos / Shutterstock)

Sem dúvida alguma, os avanços da Biologia Molecular associados às ferramentas de Bioinformática, nas últimas duas décadas, contribuíram muito para o desenvolvimento de técnicas de transferência de genes visando corrigir ou repor a expressão de determinado gene defeituoso.

Na próxima aula, veremos como elaborar um desenho experimental destinado à análise de amostras de DNA e RNA, de forma a obter resultados confiáveis para análises de Bioinformática

Síntese Proteica: transcrição, tradução e exercícios

Carolina Batista

Professora de Química

  • A síntese proteica é o mecanismo de produção de proteínas determinado pelo DNA, que acontece em duas fases chamadas transcrição e tradução.
  • O processo acontece no citoplasma das células e envolve ainda RNA, ribossomos, enzimas específicas e aminoácidos que auxiliarão na sequência da proteína a ser formada.
  • Como É Que A Informação Contida No Dna Se Expressa?Etapas da expressão gênica ou genética.
  • Em resumo, o DNA é “transcrito” pelo RNA mensageiro (RNAm) e depois a informação é “traduzida” pelos ribossomos (compostos RNA ribossômico e moléculas de proteínas) e pelo RNA transportador (RNAt), que transporta os aminoácidos, cuja sequência determinará a proteína a ser formada.

Expressão Gênica

As etapas do processo de síntese das proteínas é regulado pelos genes. Expressão gênica é o nome do processo pelo qual a informação contida nos genes (a sequência do DNA) gera produtos gênicos, que são as moléculas de RNA (na etapa de transcrição gênica) e as proteínas (na etapa de tradução gênica).

Transcrição Gênica

Nessa primeira fase a molécula de DNA se abre, e os códigos presentes no gene são transcritos para a molécula de RNA. A enzima polimerase do RNA se liga a uma das extremidades do gene, separando as fitas de DNA e os ribonucleotídeos livres se emparelham com a fita de DNA que serve de molde.

A sequência das bases nitrogenadas do RNA seguem exatamente a sequência de bases do DNA, segundo a seguinte regra:

  • U com A (Uracila-RNA e Adenina-DNA),
  • A com T (Adenina-RNA e Timina-DNA),
  • C com G (Citosina-RNA e Guanina-DNA) e
  • G com C (Guanina-RNA e Citosina-DNA).

O que determina o início e o fim do gene que será transcrito são sequências específicas de nucleotídeos, o início é a região promotora do gene e o fim é a região terminal. A polimerase do RNA se encaixa na região promotora do gene e vai até a região terminal.

Tradução Gênica

A cadeia polipeptídica é formada pela união de aminoácidos segundo a sequência de nucleotídeos do RNAm. Essa sequência do RNAm, denominada códon, é determinada pela sequência de bases da fita do DNA que serviu de molde. Desse modo, a síntese de proteínas é a tradução da informação contida no gene, por isso se chama tradução gênica.

Existe uma correspondência entre a sequência de bases nitrogenadas, que compõem o códon do RNAm, e os aminoácidos a ele associados que se denomina código genético. A combinação de trincas de bases formam 64 códons diferentes aos quais correspondem 20 tipos de aminoácidos que comporão as proteínas.

Veja na figura a seguir o círculo do código genético, que deve ser lido do meio para fora, assim por exemplo: o códon AAA está associado ao aminoácido lisina (Lys), GGU é glicina (Gly) e UUC é fenilalanina (Phe).

Como É Que A Informação Contida No Dna Se Expressa?Círculo do Código Genético. O códon AUG, associado ao aminoácido Metionina é de iniciação e os códons UAA, UAG e UGA sem aminoácidos associados, são de parada.

Leia também:  Como Saber A Quem Pertence Uma Conta Bancaria?

Diz-se do código genético que é “degenerado” porque muitos dos aminoácidos podem ser codificados pelo mesmo códon, como a serina (Ser) associada aos códons UCU, UCC, UCA e UCG.

Há no entanto o aminoácido Metionina associado a apenas um códon AUG, que sinaliza o início da tradução, e 3 códons de parada (UAA, UAG e UGA) não associados a nenhum aminoácido, que sinalizam o fim da síntese proteica.

Saiba mais sobre o Código Genético.

Formação da Cadeia Polipeptídica

Como É Que A Informação Contida No Dna Se Expressa?Representação esquemática da associação entre o ribossomo, o RNAt e o RNAm, para a formação da proteína.

A síntese da proteína começa com a associação entre um RNAt, um ribossomo e um RNAm. Cada RNAt transporta um aminoácido cuja sequência de bases, chamada anticódon, corresponde ao códon do RNAm.

O RNAt trazendo uma metionina, orientado pelo ribossomo, se liga ao RNAm onde se encontra o códon (AUG) correspondente dando início ao processo. Em seguida se desliga e outro RNAt se liga trazendo outro aminoácido.

Essa operação é repetida várias vezes formando a cadeia polipeptídica, cuja sequência de aminoácidos é determinada pelo RNAm. Quando enfim o ribossomo chega a região do RNAm onde há um códon de parada, é determinado o fim do processo.

Quem participa da Síntese?

Como É Que A Informação Contida No Dna Se Expressa?Comparação entre uma moléculas de DNA (fita dupla) e uma de RNA (fita simples).

Os genes são partes específicas da molécula de DNA, que possuem códigos que serão transcritos para o RNA. Cada gene determina a produção de uma molécula específica de RNA.

Nem toda molécula de DNA contém genes,há algumas que não tem as informações para a transcrição gênica, são DNA não-codificante, e sua função não é bem conhecida.

RNA

As moléculas de RNA são produzidas a partir de um molde de DNA. O DNA é uma fita dupla, sendo que apenas uma delas é usada para a transcrição do RNA.

No processo de transcrição participa a enzima polimerase do RNA. São produzidos 3 tipos diferentes, cada qual com função específica: RNAm – RNA mensageiro, RNAt – RNA transportador e RNAr – RNA ribossômico.

Ribossomos

Os ribossomos são estruturas presentes nas células eucarióticas e procarióticas, cuja função é sintetizar proteínas. Não são organelas pois não possuem membranas, são espécies de grânulos, cuja estrutura é composta da molécula de RNA ribossômico dobrado, associado a proteínas.

São formados por 2 subunidades e se localizam no citoplasma, livres ou associados ao retículo endoplasmático rugoso.

Confira as diferenças entre DNA e RNA.

Exercícios

1. (MACK) Os códons UGC, UAU, GCC e AGC codificam, respectivamente, os aminoácidos cisteína, tirosina, alanina e serina; o códon UAG é terminal, ou seja, indica a interrupção da tradução.

Um fragmento de DNA, que codifica a sequência serina – cisteína – tirosina – alanina, sofreu a perda da 9a base nitrogenada.

Assinale a alternativa que descreve o que acontecerá com a sequência de aminoácidos.

a) O aminoácido tirosina será substituído por outro aminoácido.
b) O aminoácido tirosina não será traduzido, resultando numa molécula com 3 aminoácidos.
c) A sequência não será traduzida, pois essa molécula de DNA alterada não é capaz de comandar esse processo.
d) A tradução será interrompida no 2o aminoácido.

e) A sequência não sofrerá prejuízo, pois qualquer modificação na fita de DNA é imediatamente corrigida.

2. (UNIFOR) “O RNA mensageiro é produzido no ____I___ e, ao nível ____II___ , associa-se a ____IIII___ participando das síntese de ____IV___ .” Para completar corretamente essa frase, I, II, III e IV devem ser substituídos, respectivamente, por:

a) ribossomo – citoplasmático – mitocôndrias – energia.
b) ribossomo – citoplasmático – mitocôndrias – DNA.
c) núcleo – citoplasmático – mitocôndrias – proteínas.
d) citoplasma – nuclear – ribossomos – DNA.

e) núcleo – citoplasmático – ribossomos – proteínas.

3. (UFRN) Uma proteína X codificada pelo gene Xp é sintetizada nos ribossomos, a partir de um RNAm. Para que a síntese aconteça, é necessário que ocorram, no núcleo e no citoplasma, respectivamente, as etapas de:

a) Iniciação e transcrição.
b) Iniciação e terminação.
c) Tradução e terminação.

d) Transcrição e tradução.

4. (UEMA) O código genético é um sistema de informações bioquímicas que permite a produção de proteínas, as quais determinam a estrutura das células e controlam todos os processos metabólicos. Marque a alternativa correta em que se encontra a estrutura do código genético.

a) Uma sequência aleatória de bases nitrogenadas A, C, T, G.
b) Uma sequência de trincas de bases do DNA indica uma sequência de nucleotídeos que devem se unir para formar uma proteína.
c) Uma sequência de trincas de bases do RNA indica uma sequência de aminoácidos que devem se unir para formar uma proteína.
d) Uma sequência aleatória de bases nitrogenadas A, C, U, G.

  1. e) Uma sequência de trincas de bases do DNA indica uma sequência de aminoácidos que devem se unir para formar uma proteína.
  2. Você também pode se interessar por:
  • Citoplasma
  • Estrutura das proteínas
  • Introdução à Genética

Técnica em Química pelo Instituto Federal de Educação, Ciência e Tecnologia de Pernambuco (2011) e Bacharelada em Química Tecnológica e Industrial pela Universidade Federal de Alagoas (2018).

Gene – funções: Código genético e síntese de proteínas

Atualizado em 25/07/2013, às 11h48

Os cromossomos são constituídos por um longo filamento de DNA associado a certas proteínas chamadas histonas. Alguns trechos do DNA presente nesses cromossomos dão início a processos de fabricação de proteínas com as mais diversas funções no organismo. Esses trechos de DNA são o que chamamos de genes.

Quanto ao RNA, cujos nucleotídios se agrupam numa cadeia simples, seus diferentes tipos também participam dos processos de síntese proteica, cada um apresentando diferentes funções.

Os genes e o processo da transcrição

O início da síntese de uma proteína se dá quando um determinado trecho de DNA, um gene, tem suas duas cadeias separadas pela ação de uma enzima chamada polimerase do RNA, que também orienta o agrupamento de nucleotídios livres no núcleo, junto a uma dessas cadeias. Esses nucleotídios unem-se, formando, então, uma molécula de RNA.

Os nucleotídios agrupam-se segundo um emparelhamento de bases nitrogenadas parecido com aquele das duas cadeias do DNA, com a diferença de que a adenina se emparelha com a uracila (A – U).

Dessa forma, se a sequência de bases nitrogenadas do DNA for, por exemplo, TACAATCGCATTCAGGTACTG, a sequência de bases do RNA formado será AUGUUAGCGUAAGUCCAUGAC.

Como É Que A Informação Contida No Dna Se Expressa?

  • Esquema do processo de transcrição gênica.

A sequência de bases transcritas a partir do DNA carrega consigo a informação codificada para a construção de uma molécula de proteína. Essa codificação se dá na forma de trincas de bases nitrogenadas, chamadas códons. No nosso exemplo, o RNAm formado possui os seguintes códons: AUG, UUA, GCG, UAA, GUC, CAU, GAC.

As proteínas são moléculas formadas por uma sequência de unidades menores chamadas aminoácidos. Como veremos mais adiante, os códons do RNA formado neste processo determinam os aminoácidos que constituirão uma determinada molécula de proteína. Eles contêm, portanto, uma mensagem para a síntese proteica e, por isso, esse RNA recebeu o nome de “mensageiro”.

O processo da tradução gênica

A etapa seguinte da síntese proteica ocorre no citoplasma das células onde o RNAm formado acopla-se a organelas chamadas ribossomos, que são constituídas por RNAr associado a proteínas. É nos ribossomos que ocorre a síntese e eles podem encontrar-se livres no citoplasma ou associados ao retículo endoplasmático rugoso.

Entra em ação, então, o terceiro tipo de RNA, o RNA transportador, que recebe esse nome em virtude de transportar com ele os aminoácidos, as unidades constituintes das proteínas. No RNAt há uma trinca de bases nitrogenadas denominadas anticódon, por meio das quais ele se liga temporariamente ao RNAm no ribossomo pelas bases complementares (códon).

Assim, no caso da sequência do exemplo dado anteriormente (AUGUUAGCGUAAGUCCAUGAC), às três primeiras bases (AUG) vai acoplar-se um RNAt com a sequência UAC; e assim por diante, como no esquema abaixo:

Como É Que A Informação Contida No Dna Se Expressa?

A síntese de uma proteína começa com o acoplamento do ribossomo ao RNAm. No ribossomo também se acopla um RNAt, cujo anticódon se liga ao códon do RNAm. Logo em seguida, outro RNAt acopla-se ao segundo códon, ou seja, um ribossomo permite que até dois RNAts se acoplem ao mesmo tempo.

Leia também:  Como E Que A Kim Kardashian Ficou Famosa?

Os aminoácidos transportados em cada RNAt unem-se entre si por meio de uma ligação química conhecida por ligação peptídica. O ribossomo, que catalisa esse processo, desloca-se então sobre o RNAm e o primeiro RNAt se desliga do conjunto ribossomo-RNAm, sendo que os aminoácidos permanecem ligados.

Em seguida, uma nova molécula de RNAt se une ao ribossomo, transportando mais um aminoácido que se junta aos outros dois. O processo continua até que todos os códons do RNAm tenham sido percorridos pelo ribossomo, recebendo os RNAt complementares e formando uma cadeia de aminoácidos, ou seja, uma molécula de proteína.

Como É Que A Informação Contida No Dna Se Expressa?

  • Esquema do processo de tradução gênica. A estrutura de cor azul claro é o ribossomo.

O código genético

Todas as proteínas presentes nos mais diferentes seres vivos são compostas por combinações entre 20 aminoácidos. Essas combinações são determinadas, como vimos, pelas sequências de códons do RNAm que foram transcritas a partir do DNA. Damos o nome de código genético à correspondência entre os códons e os aminoácidos.

Como É Que A Informação Contida No Dna Se Expressa?

  • Código genético: correspondência entre os códons do RNAm e os aminoácidos trazidos pelo RNAt ao local da síntese protéica.

As quatro bases nitrogenadas do RNAm combinam-se, três a três, formando 64 códons que correspondem a apenas 20 aminoácidos. Dois ou mais códons podem estar relacionados a um aminoácido, assim como alguns não correspondem a aminoácido nenhum. Neste último caso, são códons que determinam o término do processo de tradução.

O código genético é praticamente o mesmo para todos os seres vivos e, por isso, dizemos que ele é universal. Além de universal, ele é considerado “degenerado”, pois praticamente todos os aminoácidos são determinados por mais de um códon.

Mas qual a relação de tudo o que vimos com as características de um indivíduo? As proteínas têm importantes funções no nosso corpo: são substâncias essenciais para a construção das células dos seres vivos e atuam como enzimas, controlando praticamente todo o metabolismo celular. Portanto, os genes (as porções de DNA que transcrevem RNAm), sendo os responsáveis pelo controle da produção de proteínas, controlam também todas as características dos indivíduos.

DNA e RNA: o que é, função e mais! – Blog do Stoodi

A genética é uma das áreas mais complexas da Biologia, envolvendo, inclusive, vários conceitos de Química.

Para entender melhor como funciona essa área da ciência, é crucial conhecer os conceitos, funções, aplicações e diferenças de duas estruturas fundamentais para a vida: DNA e RNA. Esses ácidos nucleicos são essenciais para a criação e reprodução da vida, de modo que compreender suas funções é crucial para estudar genética.

Pensando nisso, trouxemos neste post tudo aquilo que você precisa saber sobre DNA e RNA para se dar bem em provas e vestibulares como o ENEM. Continue lendo e descubra mais!

O que é DNA?

  • DNA é a sigla para ácido desoxirribonucleico (em inglês, ou ADN, em português), uma molécula simples e grande, construída a partir de quatro diferentes unidades estruturais básicas e semelhantes entre si, chamadas de nucleotídeos.
  • Ao analisar o DNA, principalmente por meio de experimentos focados na difração de raios-X, os cientistas James Watson e Francis Crick perceberam que a estrutura dele é formada por duas fitas enroladas no formato de uma hélice.
  • Assim, a informação genética encontra-se codificada em uma sequência de nucleotídeos de compõem os filamentos de DNA, complementares entre si.
  • Resumidamente, é possível dizer que o DNA é, então, uma molécula estruturada em duas cadeias em forma de dupla hélice, sendo constituídas por um açúcar, um grupo fosfato e uma base nitrogenada — adenina (A), citosina (C), guanina (G) ou timina (T).
  • O fato de o DNA ter uma forma de dupla hélice é fundamental para sua replicação durante a divisão celular, já que cada hélice funciona como uma espécie de molde para a outra nova célula.

Função do DNA

  1. O DNA é a estrutura responsável pela transmissão de todas as características genéticas — como cor dos olhos, da pele e do cabelo, fisionomia, entre outras — no processo de reprodução dos seres vivos.

  2. Dessa maneira, a principal função do DNA é transportar informações contidas em suas sequências, chamadas de genes.

  3. Assim, durante o exemplo de transcrição, quando uma célula usa as informações contidas em um gene, a sequência do DNA é copiada para uma sequência de RNA complementar, que pode ser utilizada depois para compor outra sequência proteica no processo conhecido como tradução.

Além dos processos de transcrição e tradução, o DNA é responsável pela manutenção das características e informações básicas sobre o organismo na divisão celular, possibilitando a replicação da estrutura. Como citado anteriormente, a forma de dupla hélice é essencial para o sucesso dessa função.

O que é RNA?

Enquanto o DNA possui as informações fundamentais para se processar uma nova proteína, ele ainda necessita do auxílio de moléculas intermediárias. E uma delas é o RNA, ou ácido ribonucleico.

Assim, a molécula do RNA nada mais é do que uma estrutura complementar de certa região do DNA. É composto por uma única cadeia de nucleotídeos.

Entretanto, diferente do DNA, as bases nitrogenadas do RNA são a adenina (A), a guanina (G), a citosina (C) e a uracila (U), esta última substituindo a timina (T) presente na molécula de DNA.

Função do RNA

A principal função do RNA é permitir que toda a informação contida no DNA possa ser copiada e transportada até as estruturas responsáveis pela elaboração de proteínas. Entretanto, o processo se ramifica, sendo que existem três tipos diferentes de RNA para realizar funções específicas, como é possível ver abaixo:

  • RNA Ribossômico (RNAr): este RNA é o principal elemento que constitui os ribossomos, tendo o maior peso e sendo um dos principais responsáveis pela criação de novas proteínas;
  • RNA Mensageiro (RNAm): junto com o RNAr ribossômico, o RNAm mensageiro também fornece auxílio na síntese proteica, com a orientação da ordem de aminoácidos para a formação das proteínas. Também é o responsável por transportar as informações genéticas provenientes do DNA do núcleo da célula até o citoplasma. Tem peso menor que o RNA ribossômico;
  • RNA Transportador (RNAt): Como o próprio nome já explicita, o RNAt transportador é o responsável pela função de transporte das moléculas de aminoácidos que farão parte da síntese proteica. O RNAt transporta os aminoácidos até os ribossomos, organela responsável por uni-los, formando, assim, as proteínas. Em comparação com os outros, possui menor peso.

Diferença entre DNA e RNA

Como É Que A Informação Contida No Dna Se Expressa?

Além de todas as características que os distinguem apresentadas até aqui, é possível diferenciar DNA e RNA por outros fatores. A localização, por exemplo, é um deles. Enquanto o DNA é encontrado apenas no núcleo das células, o RNA é produzido nele, mas migra para o citoplasma.

A constituição de cada um também é diferente. Enquanto no RNA existe a ribose, no DNA encontramos a desoxirribose.

Além disso, as estruturas são distintas, sendo que o DNA apresenta dupla-hélice e o RNA uma hélice simples. Isso faz com que, logicamente, o DNA seja muito maior que o RNA, sendo este formado a partir de uma única fita do primeiro.

Por fim, ao comparamos as bases nitrogenadas que compõem cada uma desses ácidos nucleicos, há uma pequena diferença. Enquanto em ambos a citosina é pareada com a guanina, o RNA apresenta pareamento entre adenina e uracila e o DNA, por sua vez, pareia a adenina com a timina.

Importância do DNA e RNA

Como é possível perceber ao se analisar as características e funções, tanto do DNA quanto do RNA, é fácil entender que essas estruturas são fundamentais para a existência da vida como a conhecemos. Elas coordenam o desenvolvimento e até o funcionamento de todas as estruturas de um organismo.

Assim, é por meio dessas moléculas que os seres vivos transmitem suas informações, das mais básicas às mais importantes para a manutenção da própria vida.

No processo reprodutivo, inclusive, a mistura de características tem como principal agente o DNA, uma vez que os gametas carregam informações de ambos os pais, resultando em um indivíduo único.

E aí, curtiu nosso post? Então aproveite também para dar uma olhada nos nossos artigos sobre gametogênese, meiose e mitose! Veja também nosso guia completo de Biologia e se prepare ainda mais para o ENEM!

Como É Que A Informação Contida No Dna Se Expressa?

Seja o primeiro a comentar

Faça um comentário

Seu e-mail não será publicado.


*